Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.084100 |
Chromosome: | chromosome 12 |
Location: | 6113796 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g535800 | (1 of 1) PF13191//PF13424 - AAA ATPase domain (AAA_16) // Tetratricopeptide repeat (TPR_12) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATAGGGTGCAGCTGACGCCCGTAGCCCG |
Internal bar code: | TGAGGTCTAGAAAGTAATCTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 145 |
LEAP-Seq percent confirming: | 99.4382 |
LEAP-Seq n confirming: | 531 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGTGTGTGTGTGTGTGTGT |
Suggested primer 2: | CTTCAGTAAACTCGCAGCCC |