| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.084118 |
| Chromosome: | chromosome 3 |
| Location: | 2582968 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g160500 | TSK1 | (1 of 1) PTHR22594//PTHR22594:SF35 - ASPARTYL/LYSYL-TRNA SYNTHETASE // LYSINE--TRNA LIGASE; Lysyl-tRNA synthetase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCAGCAGGCACGCACCATGCTGATACGGC |
| Internal bar code: | GCACTGCGGCTGTCGTACAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 407 |
| LEAP-Seq percent confirming: | 96.7528 |
| LEAP-Seq n confirming: | 1460 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCAAAGCCCTCTGTGTTC |
| Suggested primer 2: | CACATTCACGTTTTGCAAGG |