Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.084223 |
Chromosome: | chromosome 12 |
Location: | 4880617 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g525200 | NOP56 | (1 of 1) K14564 - nucleolar protein 56 (NOP56); Nucleolar protein, Component of C/D snoRNPs | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTCTTCTTGCCCTCTGCCGGCGCCTCCT |
Internal bar code: | CGCCTGGTTGTACGTACGTTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 629 |
LEAP-Seq percent confirming: | 99.7876 |
LEAP-Seq n confirming: | 3758 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACGGCCTCATCTTCCACTC |
Suggested primer 2: | GTCGCGCGTATTCATACCTT |