Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.084289 |
Chromosome: | chromosome 17 |
Location: | 19905 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g696250 | (1 of 2) K03260 - translation initiation factor 4G (EIF4G) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCTGCGCCTCGCGGTGCACGTCCTCAAT |
Internal bar code: | CAGCCTGTCTTGGCGATCGTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 18 |
LEAP-Seq percent confirming: | 97.4395 |
LEAP-Seq n confirming: | 685 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTTCTTGGCAATTGGACAT |
Suggested primer 2: | CCCCTACTACTTGCAGCTCG |