| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.084333 |
| Chromosome: | chromosome 6 |
| Location: | 6752162 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g294650 | AGT1 | Alanine-glyoxylate transaminase; (1 of 2) K00830 - alanine-glyoxylate transaminase / serine-glyoxylate transaminase / serine-pyruvate transaminase (AGXT) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCTGCAATCCAGCTGCGGTGCGGCGCG |
| Internal bar code: | GATTCTATGTCTGGCGACGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 479 |
| LEAP-Seq percent confirming: | 99.4391 |
| LEAP-Seq n confirming: | 1241 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTCTGAGGAGGTTGTTGC |
| Suggested primer 2: | CGAAGTGTACCACACATGGC |