| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.084379 |
| Chromosome: | chromosome 7 |
| Location: | 102782 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g312850 | (1 of 1) PTHR31621:SF1 - DUF679 DOMAIN MEMBRANE PROTEIN 1 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTCAGGAGCTACTGGGCGTCAACACCAC |
| Internal bar code: | ACGTCGACCGCGACTCGGACAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 601 |
| LEAP-Seq percent confirming: | 99.6717 |
| LEAP-Seq n confirming: | 2429 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACACAGCGCTCCACACTG |
| Suggested primer 2: | TGCTTCGTCACGTCTGTTTC |