| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.084415 |
| Chromosome: | chromosome 1 |
| Location: | 4038152 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g026300 | (1 of 3) PF08238 - Sel1 repeat (Sel1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTTCTTGGCGTCATCGTGCGCCTGTGGC |
| Internal bar code: | CGTGCATCGAACCTCACGTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 468 |
| LEAP-Seq percent confirming: | 99.1961 |
| LEAP-Seq n confirming: | 4319 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCAGCATTTTGAGGCATA |
| Suggested primer 2: | AGGGCTAGACGACATGCAAT |