| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.084493 |
| Chromosome: | scaffold 50 |
| Location: | 3567 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre50.g761447 | (1 of 1) K03500 - 16S rRNA (cytosine967-C5)-methyltransferase [EC:2.1.1.176] (rsmB, sun) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGTGCGGTTGTGTGCGGTTGTATGTGTA |
| Internal bar code: | AAGGACTCAACGTTTATTTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 374 |
| LEAP-Seq percent confirming: | 99.7801 |
| LEAP-Seq n confirming: | 5899 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCACCCACATACACCTAC |
| Suggested primer 2: | AGATACGCGAGCAGTGAGGT |