Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.084569 |
Chromosome: | chromosome 11 |
Location: | 3452139 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g481093 | (1 of 239) IPR016024 - Armadillo-type fold | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTGCCTACTGCGCGTATAATATTGGACA |
Internal bar code: | TTGGGGTTAGAGATCGGCTCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1110 |
LEAP-Seq percent confirming: | 99.8377 |
LEAP-Seq n confirming: | 615 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTTGCTGTTTCCGTTCTTG |
Suggested primer 2: | CAGCACGACTGGTTCTACGA |