| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.084597 |
| Chromosome: | chromosome 12 |
| Location: | 6901736 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g560668 | (1 of 9) IPR000719//IPR002290//IPR011009//IPR020635//IPR027916 - Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain // Protein kinase-like domain, Apicomplexa | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGGAGTAGGAACGCGCTCCTTACTAGGG |
| Internal bar code: | GGGCCTCGGTTTAGCGCGGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 648 |
| LEAP-Seq percent confirming: | 99.4409 |
| LEAP-Seq n confirming: | 1245 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCGCATATCAATTGTGGC |
| Suggested primer 2: | ACTATCGTCTGGGTTCCGTG |