| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.084763 |
| Chromosome: | chromosome 7 |
| Location: | 3324768 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g334750 | PPP30 | (1 of 3) PTHR12320//PTHR12320:SF15 - PROTEIN PHOSPHATASE 2C // SUBFAMILY NOT NAMED; Phosphoprotein phosphatase 2C-related | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGAAACATCAGTACAGATTGCCATCGCGA |
| Internal bar code: | TCGGATTAACTCTCTTCTCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 922 |
| LEAP-Seq percent confirming: | 99.3822 |
| LEAP-Seq n confirming: | 1287 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGACAACAGACAACCCCAGG |
| Suggested primer 2: | ACAAGACCCACGACAAGACC |