Insertion junction: LMJ.RY0402.084947_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.084947
Chromosome:chromosome_10
Location:1637217
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CTGCGCACGCGGCTGCCTTGCTTCATCCCA
Internal bar code:GATTCACGGGCGTATGTCTCTA

Confirmation - LEAP-Seq

LEAP-Seq distance:495
LEAP-Seq percent confirming:99.8033
LEAP-Seq n confirming:1015
LEAP-Seq n nonconfirming:2
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:CGTGGCAGACGTACTCAGAA
Suggested primer 2:CCTCAGCCACTGATAGCCTC