| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.084947 |
| Chromosome: | chromosome 10 |
| Location: | 1637217 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g429750 | FAP417 | (1 of 1) IPR000014//IPR000104 - PAS domain // Antifreeze protein, type I; Flagellar Associated Protein 417 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCGCACGCGGCTGCCTTGCTTCATCCCA |
| Internal bar code: | GATTCACGGGCGTATGTCTCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 495 |
| LEAP-Seq percent confirming: | 99.8033 |
| LEAP-Seq n confirming: | 1015 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGGCAGACGTACTCAGAA |
| Suggested primer 2: | CCTCAGCCACTGATAGCCTC |