| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.085021 |
| Chromosome: | chromosome 1 |
| Location: | 6952877 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g050150 | NFO1 | NADH:flavin oxidoreductase/NADH oxidase; (1 of 1) 1.6.99.1 - NADPH dehydrogenase / NADPH diaphorase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTAGACAGACGGACGGTTGTGGAGGCCC |
| Internal bar code: | GCGGCCGGTATGGTGACAGACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 638 |
| LEAP-Seq percent confirming: | 57.5882 |
| LEAP-Seq n confirming: | 2956 |
| LEAP-Seq n nonconfirming: | 2177 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTCTGTTATCTCGGCTGC |
| Suggested primer 2: | CTAGCCCTGCAGTCACAACA |