| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.085152 |
| Chromosome: | chromosome 14 |
| Location: | 3840158 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g632759 | (1 of 2) 4.3.1.19 - Threonine ammonia-lyase / Threonine dehydratase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCATGCTTTGATCCGTGCAGAGCAGATTC |
| Internal bar code: | ACGAGGGCAATCACGCGGTACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 217 |
| LEAP-Seq percent confirming: | 77.6165 |
| LEAP-Seq n confirming: | 1283 |
| LEAP-Seq n nonconfirming: | 370 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGTAGGAAGCGCATGGAT |
| Suggested primer 2: | AAGGTTCAGGCAGTTAGGCA |