| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.085154 |
| Chromosome: | chromosome 17 |
| Location: | 5281722 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g736150 | POL1C,POL1-2 | DNA polymerase I, probably mitochondrial; (1 of 5) PTHR10133 - DNA POLYMERASE I | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTCGTGTAGCTTCTTGCAATCTAGGGAT |
| Internal bar code: | TGTTTCCGTGTTTAGTCAGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 591 |
| LEAP-Seq percent confirming: | 98.0611 |
| LEAP-Seq n confirming: | 2984 |
| LEAP-Seq n nonconfirming: | 59 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTTGCGAACTTTGAAGCC |
| Suggested primer 2: | GTGCGACACCAGTAGCAATG |