| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.085171 |
| Chromosome: | chromosome 12 |
| Location: | 7424569 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g556650 | APC4,DIV77 | (1 of 1) K03351 - anaphase-promoting complex subunit 4 (APC4); Anaphase promoting complex subunit 4 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGGTTCTAGCCTCCCCGCCCACTTCCC |
| Internal bar code: | GCGCAAAAGCCCTGCCGTCGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 320 |
| LEAP-Seq percent confirming: | 98.1633 |
| LEAP-Seq n confirming: | 481 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTGCAAATGGTTGCTTTT |
| Suggested primer 2: | CCCCTTAACCTCCTACCTGC |