| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.085240 |
| Chromosome: | chromosome 17 |
| Location: | 5611314 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g738050 | AGG4 | Aggregation 4; (1 of 6) PTHR15907:SF21 - DUF614 FAMILY PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGACGGCCGTGTGTCGGGCCCGGGTCA |
| Internal bar code: | GCCCGGGTGGCGGGCTAAAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 547 |
| LEAP-Seq percent confirming: | 99.5416 |
| LEAP-Seq n confirming: | 3257 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCAACCAAACGAAGCCATT |
| Suggested primer 2: | CGGCATGTCAACAAATTACG |