| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.085305 |
| Chromosome: | chromosome 5 |
| Location: | 1457708 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g244000 | (1 of 1) IPR000253//IPR009836 - Forkhead-associated (FHA) domain // Protein of unknown function DUF1399 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGTGCCGACCCTAGTGTGTAACCGGCCA |
| Internal bar code: | GGCGTTGTAGACCTGCTTATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 184 |
| LEAP-Seq percent confirming: | 99.7963 |
| LEAP-Seq n confirming: | 490 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGGATTTGCGTCACCTAT |
| Suggested primer 2: | TCTAGTCGGGTTTCGGAATG |