| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.085543 |
| Chromosome: | chromosome 6 |
| Location: | 7198984 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g297850 | DHC12,DHC1a,PCR4 | (1 of 1) PF03028//PF07728//PF08393//PF12774//PF12775//PF12777//PF12780//PF12781 - Dynein heavy chain and region D6 of dynein motor (Dynein_heavy) // AAA domain (dynein-related subfamily) (AAA_5) // Dynein heavy chain, N-terminal region 2 (DHC_N2) // Hydrolytic ATP binding site of dynein motor region D1 (AAA_6) // P-loop containing dynein motor region D3 (AAA_7) // Microtubule-binding stalk of dynein motor (MT) // P-loop containing dynein motor region D4 (AAA_8) // ATP-binding dynein motor region D5 (AAA_9); inner arm dynein heavy chain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGAGGGCAGGTGAAGCAATCTCGGCATC |
| Internal bar code: | CCTGCTGGTGAGGGCCATATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 523 |
| LEAP-Seq percent confirming: | 99.1093 |
| LEAP-Seq n confirming: | 2448 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCAAGAGAGACACGGAGC |
| Suggested primer 2: | CCTGTTGCGTATGGATGTTG |