| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.085553 |
| Chromosome: | chromosome 1 |
| Location: | 6560236 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g046850 | UBC13 | E2 Ubiquitin conjugating enzyme; (1 of 1) K04649 - ubiquitin-conjugating enzyme (huntingtin interacting protein 2) (HIP2, UBC1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCTTACACCAGCCAGCCCAGCAAGCCGC |
| Internal bar code: | TACACAGCTGTTGTCAAGATCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 704 |
| LEAP-Seq percent confirming: | 93.75 |
| LEAP-Seq n confirming: | 1050 |
| LEAP-Seq n nonconfirming: | 70 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGTGCAGGTGATAGCAGA |
| Suggested primer 2: | CCATGGGATGGTGTGTATCA |