Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.085650 |
Chromosome: | chromosome 12 |
Location: | 2463211 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g506851 | BBS3A | (1 of 2) K07951 - ADP-ribosylation factor-like protein 6 (ARL6, BBS3); Bardet-Biedl syndrome-3 associated protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGCCCGAGAACGCCGCCGGGTGAGGGGC |
Internal bar code: | GGGGCACCACAAACAACCAATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 701 |
LEAP-Seq percent confirming: | 82.7858 |
LEAP-Seq n confirming: | 9450 |
LEAP-Seq n nonconfirming: | 1965 |
LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGTCCGAACAAACATAACC |
Suggested primer 2: | CCGGGAAAGTTTGTCACAGT |