| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.085718 |
| Chromosome: | chromosome 13 |
| Location: | 3304535 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g586400 | (1 of 1) 1.14.11.23//1.14.11.9 - Flavonol synthase / FLS // Flavanone 3-dioxygenase / Naringenin,2-oxoglutarate:oxygen oxidoreductase (3-hydroxylating) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATATGAATGTGATGACACGCGCGCGTGTGT |
| Internal bar code: | TCTGCGATATGCCCGCGGTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 537 |
| LEAP-Seq percent confirming: | 97.993 |
| LEAP-Seq n confirming: | 2246 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGACTACACCGCATCATGG |
| Suggested primer 2: | GACCAGTTTTAGGGGCAACA |