| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.085905 |
| Chromosome: | chromosome 1 |
| Location: | 5482157 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g038600 | FAD7 | Omega-3-fatty acid desaturase; (1 of 1) K10257 - omega-3 fatty acid desaturase (delta-15 desaturase) (FAD8, desB) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGCCCGCTCTCTTTGTGCACACGTAGGA |
| Internal bar code: | GGTCACACCGGGTCAGATGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 527 |
| LEAP-Seq percent confirming: | 99.7481 |
| LEAP-Seq n confirming: | 11089 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATCAACGATTGTCCCAAA |
| Suggested primer 2: | TGGAGCAAAATGCTTGACTG |