Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.085951 |
Chromosome: | chromosome 6 |
Location: | 5848289 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g287900 | (1 of 1) PF10067 - Predicted membrane protein (DUF2306) (DUF2306) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTATACCACAAGTCGAACACTGCCCAAT |
Internal bar code: | GCAAGAATTTGGCAGTCTCTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 867 |
LEAP-Seq percent confirming: | 97.861 |
LEAP-Seq n confirming: | 183 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCAGTAGGGTGTCAGGTGT |
Suggested primer 2: | GCGTCCCTTGTTTTGTGTTT |