| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.085964 |
| Chromosome: | chromosome 4 |
| Location: | 1320787 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g214650 | BGS5,GSL1,GTR19 | Glucan synthase-like 1; (1 of 7) 2.4.1.34 - 1,3-beta-glucan synthase / UDP-glucose-1,3-beta-D-glucan glucosyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAGCCTTATGATGAGTGGTCCACCCCAT |
| Internal bar code: | TGGTGACATTCACCCTAAGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 334 |
| LEAP-Seq percent confirming: | 99.7472 |
| LEAP-Seq n confirming: | 5523 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGCTCTAAACCCGCTCTC |
| Suggested primer 2: | CCACTTTCTTCTCCGTGCTC |