| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.085970 |
| Chromosome: | chromosome 8 |
| Location: | 3847039 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g377600 | ATG14 | AuTophaGy related; (1 of 1) PF10186 - Vacuolar sorting 38 and autophagy-related subunit 14 (Atg14) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCTGGCGTCATGTCTTGGTTGTGTGATA |
| Internal bar code: | GCGGCGGCTCCAAGCGGAAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 608 |
| LEAP-Seq percent confirming: | 99.2585 |
| LEAP-Seq n confirming: | 10977 |
| LEAP-Seq n nonconfirming: | 82 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCCAGACGAGCAGACGTT |
| Suggested primer 2: | TGGTATCGTTCACCGTCTGA |