Insertion junction: LMJ.RY0402.086019_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.086019
Chromosome:chromosome_10
Location:1649802
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TGGAAGCGATGCTGGGATGGTGTGTTGGTT
Internal bar code:TGATTCTGAACGGACGGAGAG

Confirmation - LEAP-Seq

LEAP-Seq distance:665
LEAP-Seq percent confirming:95.1157
LEAP-Seq n confirming:81634
LEAP-Seq n nonconfirming:4192
LEAP-Seq n unique pos:121

Suggested primers for confirmation by PCR

Suggested primer 1:TGCTGTGCATGTACCTGTGA
Suggested primer 2:GAGGCTTTGATGTGTTGGGT