Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.086127 |
Chromosome: | chromosome 6 |
Location: | 3734051 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g278151 | (1 of 1) K10880 - DNA-repair protein XRCC3 (XRCC3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAGGCGGTGGTGGTGGCGTGTTGAGGTG |
Internal bar code: | GCAGAAGTCGCTACTAGCGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 237 |
LEAP-Seq percent confirming: | 53.3333 |
LEAP-Seq n confirming: | 2168 |
LEAP-Seq n nonconfirming: | 1897 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTCCTATCGAATGCATGGT |
Suggested primer 2: | GCCCTCTCTCCCCTATTCAC |