Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.086213 |
Chromosome: | chromosome 12 |
Location: | 4172529 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g518350 | CYG18 | (1 of 2) IPR001054//IPR029016//IPR029787 - Adenylyl cyclase class-3/4/guanylyl cyclase // GAF domain-like // Nucleotide cyclase; Adenylate/guanylate cyclase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGTCCTGAGCCAGAAGTGCGAGGCTGGC |
Internal bar code: | TAAGGTGTAATATCCGCGCTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 789 |
LEAP-Seq percent confirming: | 99.3151 |
LEAP-Seq n confirming: | 725 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGGAGAAGATCATGCAGC |
Suggested primer 2: | GATTTGTGCCCGCTAGGATA |