| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.086287 |
| Chromosome: | chromosome 12 |
| Location: | 1804862 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g512050 | (1 of 57) 2.7.10.2 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGGGTCTCCAGCTTCTCTCGCAGCTCCG |
| Internal bar code: | TCGCTATCGTCCTCGCAAAAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 688 |
| LEAP-Seq percent confirming: | 98.7013 |
| LEAP-Seq n confirming: | 456 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTGGAGTTCAAAGTTCGC |
| Suggested primer 2: | AACGACGTGAGCATTTACCC |