| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.086341 |
| Chromosome: | chromosome 2 |
| Location: | 3832219 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095650 | (1 of 5) 1.14.13.114 - 6-hydroxynicotinate 3-monooxygenase / HNA-3-monooxygenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTACCATTGCTCCTGCAACACCGCTCTA |
| Internal bar code: | TTCGGGGTTATTACCCTCTTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 116 |
| LEAP-Seq percent confirming: | 87.9177 |
| LEAP-Seq n confirming: | 342 |
| LEAP-Seq n nonconfirming: | 47 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTGTGACGATACTCTGGC |
| Suggested primer 2: | AAAATAACACACGCCTTGCC |