Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.086343 |
Chromosome: | chromosome 15 |
Location: | 49333 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g634600 | (1 of 1) PF12796//PF13637//PF13857 - Ankyrin repeats (3 copies) (Ank_2) // Ankyrin repeats (many copies) (Ank_4) // Ankyrin repeats (many copies) (Ank_5) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGAGGAGGAGGAGGAAGACGGCGAGGCAA |
Internal bar code: | GGCGGTTTAATTGCATACGCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 46 |
LEAP-Seq percent confirming: | 94.1176 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATACCTGCCGACATTCTTGC |
Suggested primer 2: | TTGATCTCTACCCGCATTCC |