| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.086348 |
| Chromosome: | chromosome 16 |
| Location: | 877175 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g648150 | (1 of 6) PTHR24114//PTHR24114:SF2 - FAMILY NOT NAMED // LEUCINE-RICH REPEAT-CONTAINING PROTEIN 74 | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCCCGCACACATCTCTGACCCCTGACCC |
| Internal bar code: | CGCAACGGAGTGCCTTGTAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 453 |
| LEAP-Seq percent confirming: | 54.2112 |
| LEAP-Seq n confirming: | 2787 |
| LEAP-Seq n nonconfirming: | 2354 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTGCAAGACACAAATCCC |
| Suggested primer 2: | TGCATTGTGAAGAGGACAGC |