| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.086542 |
| Chromosome: | chromosome 3 |
| Location: | 4890692 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g179450 | SRR7 | (1 of 1) K09624 - protease, serine, 12 (neurotrypsin, motopsin) [EC:3.4.21.-] (PRSS12); Scavenger receptor cysteine rich (SRCR) protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTCAGCACCTCTGAACGGCCTCCCGCCT |
| Internal bar code: | GATTTAGTTAAACTAGAGGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 808 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 712 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGGCAGGAGTAGAAGAGTG |
| Suggested primer 2: | TACTACAGGGGACAGTGGGG |