Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.086575 |
Chromosome: | chromosome 12 |
Location: | 6545442 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g539050 | (1 of 1) IPR000363//IPR016159 - Alpha 1D adrenoceptor // Cullin repeat-like-containing domain | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATCCAAAGTGCGTGAATGCGGGATGGG |
Internal bar code: | TCGTATAAGGGATCACGACACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 638 |
LEAP-Seq percent confirming: | 99.0607 |
LEAP-Seq n confirming: | 1582 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGGTGAGTGTTGAAGGGT |
Suggested primer 2: | CAGGAAGTCCTTGTGGTGGT |