| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.086575 |
| Chromosome: | chromosome 12 |
| Location: | 6545442 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g539050 | (1 of 1) IPR000363//IPR016159 - Alpha 1D adrenoceptor // Cullin repeat-like-containing domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATCCAAAGTGCGTGAATGCGGGATGGG |
| Internal bar code: | TCGTATAAGGGATCACGACACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 638 |
| LEAP-Seq percent confirming: | 99.0607 |
| LEAP-Seq n confirming: | 1582 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGGTGAGTGTTGAAGGGT |
| Suggested primer 2: | CAGGAAGTCCTTGTGGTGGT |