| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.086619 |
| Chromosome: | chromosome 2 |
| Location: | 5525286 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g108450 | FAP280 | Flagellar Associated Protein 280, transcriptional coactivator-like; (1 of 1) K03627 - putative transcription factor (MBF1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAACCTAGTCTTCCCCAGTTCCGTCTTCG |
| Internal bar code: | CTCTTAACGGTAAGAGCAGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1182 |
| LEAP-Seq percent confirming: | 99.7402 |
| LEAP-Seq n confirming: | 3455 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAAGTTGTCCCCTCCGTAA |
| Suggested primer 2: | GAAACTTGATGTGTGCGTGG |