Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.086635 |
Chromosome: | chromosome 11 |
Location: | 2772924 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g477300 | PPP36,FAP8 | Flagellar Associated Protein 8; (1 of 1) K03456 - serine/threonine-protein phosphatase 2A regulatory subunit A (PPP2R1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCGTCTGCCTGTGCCCCGCCGCAACACG |
Internal bar code: | CGACGTCCGCAGTCCCGGAGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 595 |
LEAP-Seq percent confirming: | 99.6487 |
LEAP-Seq n confirming: | 851 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCGGTCTGCATTTCTATCC |
Suggested primer 2: | TGCTCCGCAGTCATACACAT |