| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.086681 |
| Chromosome: | chromosome 3 |
| Location: | 3859957 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g170900 | (1 of 1) PTHR31935//PTHR31935:SF1 - FAMILY NOT NAMED // COILED-COIL DOMAIN-CONTAINING PROTEIN 13 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGAGGGCTAGCGTACAGTGCTTATAGT |
| Internal bar code: | ATTGGACGGGGCCCGGTCGTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 545 |
| LEAP-Seq percent confirming: | 98.6607 |
| LEAP-Seq n confirming: | 442 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCGGCATAAACAAAACAC |
| Suggested primer 2: | CGCTGAACGTACGACTGTGT |