Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.086693 |
Chromosome: | chromosome 16 |
Location: | 1095958 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g649700 | (1 of 4) 2.1.1.127 - [Ribulose-bisphosphate carboxylase]-lysine N-methyltransferase / RuBisCO methyltransferase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCCGTCGGCACTTCATACTGGGTGTCTT |
Internal bar code: | AGCTTCTGACGGTAAACGACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1064 |
LEAP-Seq percent confirming: | 99.8355 |
LEAP-Seq n confirming: | 2428 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTTTGGACGAGTACGACCG |
Suggested primer 2: | CTTTCACTCTTCCAGGCGAC |