Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.086737 |
Chromosome: | chromosome 8 |
Location: | 4623818 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g383450 | FIST N domain protein; (1 of 3) PF08495 - FIST N domain (FIST) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTACTCATGATTGCAACCCGCACCCCTCC |
Internal bar code: | GCTATTGCTTGGCAAGAGTGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 239 |
LEAP-Seq percent confirming: | 97.9954 |
LEAP-Seq n confirming: | 1271 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAAACACTCCCGTCTCCTA |
Suggested primer 2: | AGACACATAACCCCGACAGC |