| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.086746 |
| Chromosome: | chromosome 12 |
| Location: | 4553277 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g522300 | (1 of 1) IPR001611//IPR002048//IPR003590//IPR008907//IPR011992 - Leucine-rich repeat // EF-hand domain // Leucine-rich repeat, ribonuclease inhibitor subtype // P25-alpha // EF-hand domain pair | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCAGCACACCAGCACACCAGCGCTCACC |
| Internal bar code: | GACCGCTCGCCAGTCGCGGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 642 |
| LEAP-Seq percent confirming: | 99.701 |
| LEAP-Seq n confirming: | 667 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGATTGCATCACGTTGTA |
| Suggested primer 2: | GAGGGCAACATCAAGACCAT |