Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.086753 |
Chromosome: | chromosome 12 |
Location: | 4158000 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g518300 | SPL25 | Pre-mRNA splicing factor; (1 of 1) K12871 - coiled-coil domain-containing protein 12 (CCDC12) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCAACCACCCCCACCATCTCCACCCTCAC |
Internal bar code: | GTGGCATCACCTCGGGTAAATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 544 |
LEAP-Seq percent confirming: | 99.0285 |
LEAP-Seq n confirming: | 1427 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGCCTATCTAGCAGTCGC |
Suggested primer 2: | CCTCTCTGGGTAGCAAGCAC |