| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.086762 |
| Chromosome: | chromosome 7 |
| Location: | 5359306 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g350000 | TGL14 | (1 of 2) PTHR21493//PTHR21493:SF119 - CGI-141-RELATED/LIPASE CONTAINING PROTEIN // TRIGLYCERIDE LIPASE-RELATED; Putative triacylglycerol lipase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCGCCTCGCTGATCGTTGCCCAACACAA |
| Internal bar code: | CACGTACCTGGAAGTGCCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 911 |
| LEAP-Seq percent confirming: | 99.666 |
| LEAP-Seq n confirming: | 3581 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | COULD_NOT_FIND_PRIMER |
| Suggested primer 2: | AAGCAGGACGCCAAAGACTA |