| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.086778 |
| Chromosome: | chromosome 5 |
| Location: | 2789298 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g237200 | DRP4C,DRP6 | Dynamin-related GTPase; (1 of 1) IPR000375//IPR001401//IPR020850//IPR022812//IPR027417 - Dynamin central domain // Dynamin, GTPase domain // GTPase effector domain, GED // Dynamin superfamily // P-loop containing nucleoside triphosphate hydrolase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTAAGGTGAGAGCGGCAGCACAGATTAGG |
| Internal bar code: | GCGCTTTTATACTGGGTTGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1087 |
| LEAP-Seq percent confirming: | 99.6024 |
| LEAP-Seq n confirming: | 1503 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTTAACCTAGTGACCCCG |
| Suggested primer 2: | GTTGCGTGAAGAAAGAAGGC |