| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.086788 |
| Chromosome: | chromosome 17 |
| Location: | 3960365 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g728650 | FAP196 | (1 of 2) PTHR13720//PTHR13720:SF14 - WD-40 REPEAT PROTEIN // WD REPEAT-CONTAINING PROTEIN 16; Flagellar Associated Protein 196 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGCACGCGGGCACCAGCCCTCCCACAGC |
| Internal bar code: | GCATTTTCCTATTGATTCAGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 832 |
| LEAP-Seq percent confirming: | 99.2067 |
| LEAP-Seq n confirming: | 4377 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCGCTTTTCCAAACATCC |
| Suggested primer 2: | GCGTTGGTTTAAGCCCTACA |