| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.086805 |
| Chromosome: | chromosome 2 |
| Location: | 8405793 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g141606 | DHC9 | (1 of 1) IPR004273//IPR013602//IPR024317//IPR024743//IPR026983//IPR027417 - Dynein heavy chain domain // Dynein heavy chain, domain-2 // Dynein heavy chain, P-loop containing D4 domain // Dynein heavy chain, coiled coil stalk // Dynein heavy chain // P-loop containing nucleoside triphosphate hydrolase; Axonemal inner arm dynein heavy chain, dynein c (monomeric) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATGAATTTTAACCCGCTCTCCACCCCCA |
| Internal bar code: | GCCCCAGACGAAGTCCGTAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 442 |
| LEAP-Seq percent confirming: | 99.0291 |
| LEAP-Seq n confirming: | 102 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGAGAGGAAGACGGCAAG |
| Suggested primer 2: | GGGTTGTAAATAGCAGCCCA |