| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.086821 |
| Chromosome: | chromosome 9 |
| Location: | 4296811 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394732 | AZI1,MOT3,CEP131 | Centrosomal Protein 131; (1 of 1) K16540 - 5-azacytidine-induced protein 1 (AZI1, CEP131) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGTATGCGGCTGGTTTCCGACGCCGACC |
| Internal bar code: | TATTAACCATGTCTGCTCTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 102 |
| LEAP-Seq percent confirming: | 98.5149 |
| LEAP-Seq n confirming: | 199 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGGCACAGCACTATCGAA |
| Suggested primer 2: | CCAAGGATTTTTGTGTGCCT |