| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.086860 |
| Chromosome: | chromosome 6 |
| Location: | 4001691 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278199 | (1 of 4) 1.13.11.75 - All-trans-8'-apo-beta-carotenal 15,15'-oxygenase / 8'-apo-beta-carotenal 15,15'-oxygenase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGTGCAGTATGGCTGGCTCGCCGTCCCG |
| Internal bar code: | TGCGGGTCAAACGGGGGTGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 205 |
| LEAP-Seq percent confirming: | 34.5563 |
| LEAP-Seq n confirming: | 1620 |
| LEAP-Seq n nonconfirming: | 3068 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACACACCTCCCTGTC |
| Suggested primer 2: | CAGTTCAAGAGCGTCGTCAC |