| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.086870 |
| Chromosome: | chromosome 11 |
| Location: | 2770715 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g477300 | PPP36,FAP8 | Flagellar Associated Protein 8; (1 of 1) K03456 - serine/threonine-protein phosphatase 2A regulatory subunit A (PPP2R1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGACTTGACAGCTAATGGCGTGCGCCA |
| Internal bar code: | CGGGATGCCGTAGTAACGACCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 96 |
| LEAP-Seq percent confirming: | 0.990364 |
| LEAP-Seq n confirming: | 74 |
| LEAP-Seq n nonconfirming: | 7398 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTGACCCGGTAAGAGTGC |
| Suggested primer 2: | AGCACGCTCAAATCCTGACT |