| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.086880 |
| Chromosome: | chromosome 12 |
| Location: | 6929877 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g560550 | MTF1 | (1 of 2) 2.1.2.9 - Methionyl-tRNA formyltransferase / transformylase; Methionyl-tRNA formyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGCGCCTGGCCTGCCTGTGTCACAGCGA |
| Internal bar code: | CCCCACCGGCAGCCCCACACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 241 |
| LEAP-Seq percent confirming: | 50.3294 |
| LEAP-Seq n confirming: | 1375 |
| LEAP-Seq n nonconfirming: | 1357 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAAATTTGCGCACTGCTAA |
| Suggested primer 2: | GCATAGCGAGGAGGTCAGTC |